The Create Insertion template, located in the Templates panel, prompts you to enter a sequence and to separately define the range of values that will go before and after the insertion, as well as to enter text for the insertion itself. Later, when you run the script, SeqNinja will output a file consisting of the bracketing ranges and the insertion. This template is particularly useful if you need to migrate annotations between different versions of a genome while still preserving features.
- In the Choose Sequence(s) button row, choose the sequence for which you wish to create an insertion (see Add and modify a sequence).
- In the upper Specify a range of the sequence area, input the first and last base number of the part of the sequence that will go before the insertion (see Set sequence ends).
- In the Type sequence text box, type the insertion. Only nucleotides and amino acids are allowed.
- In the lower Specify a range of the sequence area, input the first and last base number of the part of the sequence that will go after the insertion (see Set sequence ends).
- In the Save Results As area, choose the name and location in which to save the output (see Specify output format and location).
Example:
Input sequence: GGAGTCTCCCATTGATTACA
Contents of the results file: GGAGTTTTGGGCTCCCATTGATTACA
Need more help with this?
Contact DNASTAR